genes encoding the various bla tem genes  (Gen9 Inc)

Journal: Antimicrobial Agents and Chemotherapy

Article Title: Role of Synonymous Mutations in the Evolution of TEM β-Lactamase Genes

doi: 10.1128/AAC.00018-21

Figure Lengend Snippet: Summary of the characteristics of the different bla TEM gene constructs without (−sm) and with (+sm) synonymous mutations

Article Snippet: Genes encoding the various bla TEM genes were purchased from Gen9, Inc. (Cambridge, MA) or Biomatik (Kitchener, ON, Canada); genes had a SacI restriction site followed by a ribosome binding site (5′- GAGCTCAAGAAGGAGATATACAT -3′) on the 5′ terminus and a BamHI restriction site (5′-GGATCC-3′) immediately following the 3′ terminal stop codon.

Techniques: Construct, Expressing

Journal: Antimicrobial Agents and Chemotherapy

Article Title: Role of Synonymous Mutations in the Evolution of TEM β-Lactamase Genes

doi: 10.1128/AAC.00018-21

Figure Lengend Snippet: Summary of the characteristics of the different gene constructs from bla TEM-1 to bla TEM-33 (+sm) c

Article Snippet: Genes encoding the various bla TEM genes were purchased from Gen9, Inc. (Cambridge, MA) or Biomatik (Kitchener, ON, Canada); genes had a SacI restriction site followed by a ribosome binding site (5′- GAGCTCAAGAAGGAGATATACAT -3′) on the 5′ terminus and a BamHI restriction site (5′-GGATCC-3′) immediately following the 3′ terminal stop codon.

Techniques: Construct, Diffusion-based Assay, Microdilution Assay